Mekk1

Suggest Content
Advertise Here
Gene DB Home

Symbol:	Mekk1
Name(s):	Mekk1
Type:	protein-coding
Organism:	Drosophila melanogaster
Synonyms:	CG7717, D-MEKK1, DmMEKK1, MEKK, MEKK4, Mekk1/4, dMEKK, dMEKK4, mekk1a, mekk1b
Links:	Pubmed, Entrez Gene, Map Viewer.

Gene Information from Publications
Publication Link	Summary of findings
16451733	D-MEKK1, the fly orthologue of mammalian MEKK4/MTK1, and Hemipterous/D-MKK7 mediates the activation of D-JNK by cadmium and arsenite.

Mekk1 results (if any) from reagent suppliers

MEKK1 antibody (ab55653) datasheet \| Abcam Mouse monoclonal to MEKK1. MEKK1 (MEK kinase 1) also known as MAP3K is a serine/ threonine kinase that is a member network of phosphorylating enzymes which ... http://www.abcam.com/index.html?datasheet=55653...
MEKK1 Antibody (C-term) Abgent develops powerful tools to profile posttranslational modifications related to cellular function and disease. Abgent antibodies target protein kinases ... http://www.abgent.com/catalog_no/AP7907a...
MEKK1 antibodies \| Abcam MEKK1 antibodies. ... MEKK1 antibody. WB. Rabbit polyclonal. Reacts with:. Hu, Ms, Rat. ©1998-2008 Abcam plc. All rights reserved. ... http://www.abcam.com/index.html?t=134418&pt=1&c=2125...
MEKK1 Antibody (C-term) MEKK1 can phosphorylate and activate MAPKK 1 and MAPKK 2 (MEK1/MEK2) which leads to phosphorylation of MAP kinases. It is also a highly efficient activator ... http://www.abgent.com/products/catalog_no/AP7907a/techsuppor...
pCMV-MEKK1 Vector Information Restriction Map of pCMV-MEKK1. All restriction sites shown are unique. ... pCMV- MEKK1 is designed for the constitutive expression of MEK Kinase 1 (MEKK1) in ... http://www.clontech.com/images/pt/PT3385-5.pdf...
MEKK1 Mouse, Recombinant Expressed in E. coli Product Number M6939 ... MEKK1 is produced from a DNA sequence ... catalytic subunit of MEKK1. The accession number for ... MEKK1 it a major regulator of the JNK protein kinase ... http://www.sigmaaldrich.com/sigma/datasheet/M6939dat.pdf...
Digest 1 of pCMV-MEKK1: 4950 bases (circular) \| AseI ... Digest 1 of pCMV-MEKK1: 4950 bases (circular). Tue, Jul 13, 1999. Page. \|. AseI. TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAA ... http://www.clontech.com/images/pt/PT3385-SEQ.pdf...
GCK Antibody #3782 GCK does not significantly phosphorylate MEKK1, instead it enhances MEKK1 oligomerization and autophosphorylation (3). GCK binds and activates MLK3, ... http://www.cellsignal.com/products/3782.html...
Dephosphorylation of Proteins with Shrimp Alkaline Phosphatase-eNotes This article shows an example of this technique used to examine the possible phosphorylation of two corepressors, N-CoR and SMRT by MEKK1. ... http://www.promega.com/enotes/applications/ap0059.htm...
STK38 antibody (ab56977) datasheet \| Abcam STK38 negatively regulates the activation of MEKK1/2 by direct ... The negative regulation of MEKK1/2 is not due to its phosphorylation by STK38. ... http://www.abcam.com/index.html?datasheet=56977...

Search Bioportfolio and other Life Science Sites for Mekk1
This page has been viewed 39 times
Resources from the NCBI used on this page, NCBI's standard disclaimer applies.

Nothing in this website should be used in place of personal medical advice from your own qualified medical practitioner.

All rights reserved. All other trademarks recognized.
Copyright 1997-2008 - BioPortfolio Limited.