BioPortfolio Biotechnology Pharmaceutical Healthcare Medical Life Science Drug Discovery Disease

Image Results

Loading...
Loading...

Tube1.com Pages on BioPortfolio:

BioPortfolio - TUBE1 - tubulin, epsilon 1
TUBE1 - tubulin, epsilon 1 - Bioportfolio. ... Search Bioportfolio and other Life Science Sites for TUBE1 This page has been viewed 5229 times ...
http://www.bioportfolio.com/gene/51175-TUBE1.html...

Antibody By Gene - T
... beta polypeptide pseudogene 2 · TUBBP3 tubulin, beta polypeptide pseudogene 3 · TUBBP5 tubulin, beta polypeptide pseudogene 5 · TUBE1 tubulin, epsilon 1 ...
http://www.bioportfolio.co.uk/antibody/genes-T.htm...

BioPortfolio - Most Popular Pages on Bioportfolio's Gene Database
Gene, Description, Views. TUB8, TUB8 (tubulin beta-8), 10227. TUBE1, tubulin, epsilon 1, 5212. CAM4, CAM4 (CALMODULIN 4); calcium ion binding, 4887 ...
http://www.bioportfolio.com/gene/mostpopular.php...

Results from other life science and pharmaceutical sites:

BioPortfolio - http www.tube1.com
4 Sep 2008 ... TUBE1 - tubulin, epsilon 1 - Bioportfolio. ... Search Bioportfolio and other Life Science Sites for TUBE1 This page has been viewed 5229 ...
http://www.bioportfolio.com/search/http___www.tube1.com_.htm...

TUBE1 - SNP Result
1: rs16291545 [Gallus gallus]TTCTGCTGATAAATCATTTTGTCTGC[-/TT] TTTTTTTTTGTTGTTGTTGCTGCTG 2: rs16291544 [Gallus ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp&cmd=search&s...

Beckman Coulter - Cap Assembly, Tube, 1 in, 25 mm, Aluminum
Product detail for Cap Assembly, Tube, 1 in, 25 mm, Aluminum cap, assembly.
http://www.beckmancoulter.com/eCatalog/CatalogItemDetails.do...

AceView: gene:TUBE1, a comprehensive annotation of human, mouse ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs ...
http://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/av.cgi?db=h...

Waters: Assy, Tube 1/4 Solvent Inlet
Assy, Tube 1/4 Solvent Inlet [700001485]. Quantity: Add to Cart. Overview, Specifications. Assy, Tube 1/4 Solvent Inlet. This spare part is a genuine
Waters ...
https://www.waters.com/waters/partDetail.htm?locale=en_US&pa...

Tubulin, epsilon 1 (TUBE1)
Human protein-coding gene TUBE1. Represented by 228 ESTs from 116 cDNA libraries . Corresponds to reference sequence NM_016262.4. [UniGene 136302 - Hs.34851]
http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=348...

Waters: PEEK Tube, 1/16 x .007in., 5m
PEEK Tube, 1/16 x .007in., 5m [6436010-S5]. Quantity: Add to Cart. Overview, Specifications. This part number replaces part number 700003235. PM Kit, No ...
https://www.waters.com/waters/partDetail.htm?locale=en_US&pa...

51175 - Gene Result
1: TUBE1 Official Symbol TUBE1 and Name: tubulin, epsilon 1 [Homo sapiens] Other Aliases: RP1-142L7.1, FLJ22589, FLJ44203, TUBE, dJ142L7.2 Other ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&term=51175...

Waters: PEEK Tube, 1/16 x .007in., 1m
PEEK Tube, 1/16 x .007in., 1m [6436010-S1]. Quantity: ... PEEK Tube, 1/16 x . 007in., 1m. This spare part is a genuine Waters Quality Part ...
https://www.waters.com/waters/partDetail.htm?locale=en_US&pa...

[Pulsatile flow in an elastic circular tube. 1. The application of ...
[Pulsatile flow in an elastic circular tube. 1. The application of the finite Hankel transforms to the equations for the flow]. [Article in Japanese] ...
http://www.ncbi.nlm.nih.gov/pubmed/2640800...

Google Custom Search

Search
  


 

Nothing in this website should be used in place of personal medical advice from your own qualified medical practitioner.

All rights reserved. All other trademarks recognized.
Copyright 1997-2009 - BioPortfolio Limited.