|
| |
UBE2T Pages on BioPortfolio:
BioPortfolio - UBE2T - ubiquitin-conjugating enzyme E2T (putative)
Elevated expression of UBE2T in lung cancer tumors and cell lines. The aim of this study was to investigate the association between UBE2T, a. ...
http://www.bioportfolio.com/gene/29089-UBE2T.html...
|
BioPortfolio - enzyme UBE2T and fancd2
enzyme UBE2T and fancd2 - BioPortfolio. ... Recent Search Terms used to find this page: enzyme UBE2T and fancd2 | UBE-2T ... conjugating enzyme UBE2T to ...
http://www.bioportfolio.com/search/enzyme_UBE2T_and_fancd2.h...
|
BioPortfolio - UBE2T research
UBE2T research - Bioportfolio. ... Elevated expression of UBE2T in lung cancer tumors and cell lines. The aim of this study was to investigate the ...
http://www.bioportfolio.com/gene/29089-UBE2T/research.html...
|
BioPortfolio - ubiquitin-conjugating enzymes
The E2 ubiquitin conjugating enzyme UBE2T along with a multi-protein E3 . ... 16916645, UBE2T is the ubiquitin-conjugating enzyme (E2) in the Fanconi anemia
...
http://www.bioportfolio.com/search/ubiquitin-conjugating_enz...
|
BioPortfolio - fancl uk
UBE2T binds to FANCL, the ubiquitin ligase subunit of the Fanconi . ... reconstitute this monoubiquitination reaction with Ube2t and the FANCL protein,
. ...
http://www.bioportfolio.com/search/fancl_uk.html...
|
BioPortfolio - fanconi anemia complementation core
UBE2T, the Fanconi anemia core complex, and FANCD2 are recruited independently . .. http://www.bioportfolio.com/indepth/Fanconi_Anemia_Complemen. ...
http://www.bioportfolio.com/search/fanconi_anemia_complement...
|
BioPortfolio - Ubiquitin-Conjugating Enzymes
16916645, UBE2T is the ubiquitin-conjugating enzyme (E2) in the Fanconi anemia pathway and has a self-inactivation mechanism that could be important for . ...
http://www.bioportfolio.com/search/Ubiquitin-Conjugating_Enz...
|
BioPortfolio - fancd2 expression profile
Elevated expression of UBE2T in lung cancer tumors and cell lines. ... UBE2T, the Fanconi anemia core complex, and FANCD2 are recruited independently to . ...
http://www.bioportfolio.com/search/fancd2_expression_profile...
|
BioPortfolio - Fanconi Anemia Complementation Group L Protein ...
UBE2T, the Fanconi anemia core complex, and FANCD2 are recruited ... UBE2T is the E2 in the Fanconi anemia pathway and undergoes negative autoregulation. ...
http://www.bioportfolio.com/indepth/Fanconi_Anemia_Complemen...
|
BioPortfolio - UBE DISEASES
BioPortfolio - UBE2T - ubiquitin-conjugating enzyme E2T (putative) ... UBE Antibody / UBE Antibodies UBE2T (4E5) Antibody, sc-100623, mouse IgG2b, . ...
http://www.bioportfolio.com/search/UBE_DISEASES.html...
|
Results from other life science and pharmaceutical sites:
AceView: gene:UBE2T, a comprehensive annotation of human, mouse ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs ...
http://www.ncbi.nlm.nih.gov/AceView/av.cgi?db=human&l=UBE2T...
|
Molecular Cell - UBE2T Is the E2 in the Fanconi Anemia Pathway and ...
Here, we show that UBE2T is the ubiquitin-conjugating enzyme (E2) essential for this pathway. UBE2T binds to FANCL, the ubiquitin ligase subunit of the ...
http://www.cell.com/molecular-cell/abstract/S1097-2765(06)00...
|
Gene Result
1: UBE2T Official Symbol UBE2T and Name: ubiquitin-conjugating enzyme E2T ( putative) [Homo sapiens] Other Aliases: HSPC150, PIG50 Other Designations: ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=retriev...
|
BioPortfolio - UBE2T - ubiquitin-conjugating enzyme E2T (putative)
Elevated expression of UBE2T in lung cancer tumors and cell lines. The aim of this study was to investigate the association between UBE2T, a. ...
http://www.bioportfolio.com/gene/29089-UBE2T.html...
|
UBE2T - SNP Result
... [Bos taurus]CACCGTCTGCCGGTGTGTCCACTCCA[C/T]GGGCTGGGTCATGGCTACAGAGCCT 2: rs41822004 [Bos taurus]CGGCCCTCCGCAGCGGCCCGCCATGA[A/G]TGTCAGCTGCCCTCCTGTCATGGCC
...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp&cmd=search&s...
|
UBE2T (4E5) Antibody sc-100623
mouse monoclonal IgG2b, 100µg/ml; recommended for detection of UBE2T of human ... Western blot analysis of UBE2T expression in HeLa whole cell lysate. ...
http://www.scbt.com/datasheet-100623-ube2t-4e5-antibody.html...
|
UBE2T, the Fanconi Anemia Core Complex, and FANCD2 Are Recruited ...
The Fanconi anemia (FA) nuclear core complex and the E2 ubiquitin-conjugating enzyme UBE2T are required for the S phase and DNA damage-restricted ...
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=21...
|
Elevated expression of UBE2T in lung cancer tumors and cell lines.
The aim of this study was to investigate the association between UBE2T, a member of the ubiquitin-conjugating E2 family, and lung cancer, which has never ...
http://www.ncbi.nlm.nih.gov/pubmed/18667844...
|
UBE2T siRNA (h) sc-78641
Click here for details. suitable control antibody: contact Technical Service for availability of control antibody; RT-PCR Primer also available: UBE2T ...
http://www.scbt.com/datasheet-78641-ube2t-sirna-h.html...
|
Supplemental Data Mechanistic Insight into Site-Restricted ...
Ube2t proteins were expressed and purified as described for Ube2w. ... (A) Ube2t and (B) Ube2w were assayed for their ability to form covalent ubiquitin ...
http://download.cell.com/molecular-cell/mmcs/journals/1097-2...
|
|
