ZDHHC9 Pages on BioPortfolio:

BioPortfolio - ZDHHC9 - zinc finger, DHHC-type containing 9
Microarray analysis on pooled samples has previously identified ZDHHC9. ... Mutations in ZDHHC9, which encodes a palmitoyltransferase of NRAS and HRAS, ...
http://www.bioportfolio.com/gene/51114-ZDHHC9.html...

BioPortfolio - GOLGA7 - golgi autoantigen, golgin subfamily a, 7
Ptm: Palmitoylated by the ZDHHC9-GOLGA7 complex. A continuous cycle of de- and re-palmitoylation regulates rapid exchange between plasma membrane and Golgi.
...
http://www.bioportfolio.com/gene/51125-GOLGA7.html...

BioPortfolio - MND1
THAP4 84057 MND1 8527 DGKD 51114 ZDHHC9 84291 MGC2408 8556 CDC14A 51133 KCTD3 .. . http://www.bioportfolio.com/search/FAM96A.html... BioPortfolio - ATMND1 ...
http://www.bioportfolio.com/search/MND1.html...

BioPortfolio - ZDHHC5 - zinc finger, DHHC-type containing 5
ZDHHC5 belongs to the DHHC palmitoyltransferase family, ERF2/ZDHHC9 subfamily. Palmitoylation plays a significant role in . ...
http://www.bioportfolio.com/gene/25921-ZDHHC5.html...

BioPortfolio - SH3GL2
BioPortfolio - ZDHHC9 SFRS7 10528 NOL5A 51020 HDDC2 6456 SH3GL2 10565 ... ENSMUSG00000000295 Hddc2 ENSMUST00000000304 774 531 6 no no no no ? ...
http://www.bioportfolio.com/search/SH3GL2.html...

Antibody By Gene - Z
... ZDHHC7 zinc finger, DHHC domain containing 7 · ZDHHC8 zinc finger, DHHC domain containing 8 · ZDHHC9 zinc finger, DHHC domain containing 9 ...
http://www.bioportfolio.co.uk/antibody/genes-Z.htm...

Results from other life science and pharmaceutical sites:

Gene Result
1: ZDHHC9 Official Symbol ZDHHC9 and Name: zinc finger, DHHC-type containing 9 [ Homo sapiens] Other Aliases: RP6-190D15.1, CGI-89, CXorf11, DHHC9, ZDHHC10, ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=retriev...

ZDHHC9 - SNP Result
... [Bos taurus]AATTGTATCAAAGGGTACAAAATTCA[G/T]TCTGAAAATACAGAAAAATATACTA 2: rs41999570 [Bos taurus]AAATTGTATCAAAGGGTACAAAATTC[A/T]GTCTGAAAATACAGAAAAATATACT
...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp&cmd=search&s...

Mutations in ZDHHC9, Which Encodes a Palmitoyltransferase of NRAS ...
We have identified one frameshift mutation, one splice-site mutation, and two missense mutations in highly conserved residues in ZDHHC9 at Xq26.1 in 4 of ...
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=18...

HomoloGene Result
Gene conserved in Eukaryota ZDHHC9 zinc finger, DHHC-type containing 9 Homo sapiens ZDHHC9 zinc finger, DHHC-type containing 9 Pan troglodytes ZDHHC9 zinc
...
http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=Retrieve&db=hom...

British Journal of Cancer - Differential expression of DHHC9 in ...
Microarray analysis on pooled samples has previously identified ZDHHC9 (DHHC9) ... One of these was EST AA232508, identified as part of the ZDHHC9 gene and ...
http://www.nature.com/bjc/journal/v96/n12/full/6603818a.html...

Supplementary Table 3 Time course of estrogen-regulated genes in ...
... SFRS7 10528 NOL5A 51020 HDDC2 6456 SH3GL2 10565 ARFGEF1 51053 GMNN 6478 SIAH2 10575 CCT4 51073 MRPL4 6491 STIL 10578 GNLY 51114 ZDHHC9 6510 SLC1A5 10589
...
ftp://ftp.ncbi.nih.gov/pub/geo/DATA/supplementary/series/GSE...

KO vs WT_p05_t test with FDR_a
51, scl54291.11_376-S, 854.7838, 0, 516.3006, 0, -20.47701, 0.00896, Zdhhc9, Mus musculus zinc finger DHHC domain containing 9 (Zdhhc9) mRNA. ...
http://www.biomedcentral.com/content/supplementary/1471-2202...

Differential expression of DHHC9 in microsatellite stable and ...
Microarray analysis on pooled samples has previously identified ZDHHC9 (DHHC9) to be upregulated in colon adenocarcinoma compared to normal colon mucosa. ...
http://www.nature.com/bjc/journal/v96/n12/abs/6603818a.html...

Nothing in this website should be used in place of personal medical advice from your own qualified medical practitioner.