|
| |
cxcr3 Pages on BioPortfolio:
BioPortfolio - CXCR3 - chemokine (C-X-C motif) receptor 3
A common intronic variant of CXCR3 is functionally associated with gene ... BACKGROUND: CXCR3 is a chemokine receptor that plays important roles in. ...
http://www.bioportfolio.com/gene/2833-CXCR3.html...
|
BioPortfolio Biotechnology BioNews : live article
... evidenced by a significant decrease in the expression of IFN-gamma, but not IL-4, and a decrease in Th1-type chemokine receptors CCR5, CXCR3, and CXCR4. ...
http://www.bioportfolio.co.uk/cgi-bin/dialogserver.exe?CMD=h...
|
Blocking the CXCL10:CXCR3 axis for the treatment of COPD
CXCR3 expression in inflammatory cells is highly limited to activated, as opposed to ... Hence blocking the production of CXCL10 or its activation of CXCR3 ...
http://www.bioportfolio.com/LeadDiscovery/PubMed-010402.html...
|
BioPortfolio - CXCR3 - InDepth
View the current CXCR3 InDepth page on BioPortfolio.com ... Differential expression of the CXCR3 ligands in chronic hepatitis C, and their modulation by HCV ...
http://www.bioportfolio.com/indepth/CXCR3.pdf...
|
BioPortfolio - CXCR3
CXCR3 - BioPortfolio - Indepth. ... Natural killer cell accumulation in tumors is dependent on IFN-gamma and CXCR3 ligands. Several studies have correlated ...
http://www.bioportfolio.com/indepth/CXCR3.html...
|
BioPortfolio - Antibody cxcr3 rabbit anti mouse
incubated with a rabbit anti-mouse CXCR3 polyclonal antibody (Zymed) or with normal ... BioPortfolio - cxcr3 antibody rabbit anti mouse affinity purified . ...
http://www.bioportfolio.com/search/Antibody_cxcr3_rabbit_ant...
|
BioPortfolio - cxcr3 and ihc
cxcr3 and ihc - BioPortfolio. ... myeloma with B cells obtained from a mouse inoculated with human CXCR3- transfected. ... Flow Cyt, IHC-P, Neut, ...
http://www.bioportfolio.com/search/cxcr3_and_ihc.html...
|
BioPortfolio - cxcr3 antibody rabbit anti mouse affinity purified
C1366, Anti-CXCR3 antibody produced in rabbit affinity isolated antibody, ... Recent Search Terms used to find this page: cxcr3 and ihc | cxcr3 antibody ...
http://www.bioportfolio.com/search/cxcr3_antibody_rabbit_ant...
|
BioPortfolio - CXCR3 2Ar1
CXCR3 2Ar1 - BioPortfolio. ... BioPortfolio - CXCR3 2Ar1 Recent Search Terms used to find this page: cxcl11 tobacco | anti-human CXCR3 antibody | clone 2Ar1 ...
http://www.bioportfolio.com/search/CXCR3_2Ar1.html...
|
BioPortfolio - cxcr3 qsar
cxcr3 qsar - BioPortfolio. ... A novel QSAR model for predicting the inhibition of CXCR3 receptor by ... http:/ ...
http://www.bioportfolio.com/search/cxcr3_qsar.html...
|
Results from other life science and pharmaceutical sites:
Gene Result
1: CXCR3 Official Symbol CXCR3 and Name: chemokine (C-X-C motif) receptor 3 [ Homo sapiens] Other Aliases: CD182, CD183, CKR-L2, CMKAR3, GPR9, IP10-R, Mig-R, ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=retriev...
|
BioPortfolio - CXCR3 - chemokine (C-X-C motif) receptor 3
A common intronic variant of CXCR3 is functionally associated with gene ... BACKGROUND: CXCR3 is a chemokine receptor that plays important roles in. ...
http://www.bioportfolio.com/gene/2833-CXCR3.html...
|
AceView: gene:CXCR3, a comprehensive annotation of human, mouse ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs ...
http://www.ncbi.nlm.nih.gov/AceView/av.cgi?db=human&l=CXCR3...
|
Oncogene - Abstract of article: Chemokine receptor CXCR3 promotes ...
Chemokine receptor CXCR3 promotes colon cancer metastasis to lymph nodes ... We have recently demonstrated that CXCR3 plays a critical role in metastasis of ...
http://www.nature.com/onc/journal/v26/n32/abs/1210267a.html...
|
Both CXCR3 and CXCL10/IFN-inducible protein 10 are...[J Immunol ...
Following intracerebral infection with dengue virus, CXCR3-deficient (CXCR3(-/-) ) ... Our results suggest that both CXCR3 and CXCL10/IP-10 contribute to ...
http://www.ncbi.nlm.nih.gov/pubmed/16849497...
|
CXCR3/CXCL10 Expression in the Synovium of Children
21 Mar 2005 ... IFNγ-inducible protein 10 and its receptor interactions may be involved in the pathophysiology of juvenile idiopathic arthritis by ...
http://www.medscape.com/viewarticle/499447...
|
CXCR3 is involved in tubulointerstitial injury in ...[Am J Pathol ...
The chemokine receptors CXCR3 and CCR5 are expressed on activated T ... Detailed description of CXCR3 expression might form a rational basis for use as a ...
http://www.ncbi.nlm.nih.gov/pubmed/14742268...
|
High CXCR3 Expression in Synovial Mast Cells
Rheumatoid arthritis (RA) is a chronic disease of joints that is characterized by three main manifestations, namely inflammation, abnormal cellular and ...
http://www.medscape.com/viewarticle/460705...
|
CXCR3 - SNP Result
... taurus]TCACAGGCCAGCTGGGCCTTTGCTGA[C/G]ACTGCCGATATAGCTGGAGGTGGGA 2: rs35605133 [Homo sapiens]ACTTAATTAGGGGGCACTGACAGTGC[-/A] AGTAGACCCACCTTGTCACCTTCTG 3: ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp&cmd=search&s...
|
BioMed Central | Full text | CXCL10 and CXCR3 modulate morbidity ...
23 Sep 2008 ... CXCL10 and CXCR3 modulate morbidity and brain invasion by parasites and T-cells in an African Trypanosomiasis mouse model ...
http://www.biomedcentral.com/1753-6561/2/S1/P1...
|
|