BioPortfolio Biotechnology Pharmaceutical Healthcare Medical Life Science Drug Discovery Disease

Image Results

Loading...
Loading...

T Uba8 Pages on BioPortfolio:

BioPortfolio - TUBA8 - tubulin, alpha 8
Search Bioportfolio and other Life Science Sites for TUBA8, or search for TUBA8 on BioPortfolio's antibody search engine. ...
http://www.bioportfolio.com/gene/51807-TUBA8.html...

Antibody By Gene - T
Antibody Index By Gene - T. T T, brachyury homolog (mouse) · TAC1 tachykinin, precursor 1 (substance K, substance P, neurokinin 1, neurokinin 2, ...
http://www.bioportfolio.co.uk/antibody/genes-T.htm...

BioPortfolio - Gene DB Search - T
Gene DB Search - T - BioPortfolio. ... BioPortfolio Antibody Database - T Human. Genes listed by symbol: T | TA-NFKBH | TAAR1 | TAAR2 | TAAR5 | TAAR6 ...
http://www.bioportfolio.com/antibody/human-T.htm...

BioPortfolio - Most Popular Pages on Bioportfolio's Gene Database
BRCA2, breast cancer 2, early onset, 5023. RSF1, remodeling and spacing factor 1 , 4140. MSMB, microseminoprotein, beta-, 4034. TUBA8, tubulin, alpha 8, 3015 ...
http://www.bioportfolio.com/gene/mostpopular.php...

BioPortfolio - Optic Nerve - InDepth
Mutation of the Variant alpha-Tubulin TUBA8 Results in Polymicrogyria with Optic Nerve Hypoplasia. The critical importance of cytoskeletal function for ...
http://www.bioportfolio.com/indepth/Optic_Nerve.pdf...

BioPortfolio - Most Popular Pages on Bioportfolio's Gene Database
BRCA2, breast cancer 2, early onset, 4705. RSF1, remodeling and spacing factor 1 , 3833. MSMB, microseminoprotein, beta-, 3719. TUBA8, tubulin, alpha 8, 2835 ...
http://www.bioportfolio.com/gene/mostpopular.php/...

Results from other life science and pharmaceutical sites:

TUBA8 - Wikipedia, the free encyclopedia
20 Oct 2009 ... "TUBA8: A new tissue-specific isoform of alpha-tubulin that is highly conserved in human and mouse". Biochem Biophys Res Commun 270 (3): ...
http://en.wikipedia.org/wiki/TUBA8...

51807 - Gene Result
1: TUBA8 Official Symbol TUBA8 and Name: tubulin, alpha 8 [Homo sapiens] Other Aliases: TUBAL2 Other Designations: tubulin, alpha-like 2 Chromosome: 22; ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&term=51807...

AJHG - Mutation of the Variant α-Tubulin TUBA8 Results in ...
By autozygosity mapping, we show that the molecular basis for this condition is mutation of the TUBA8 gene, encoding a variant α-tubulin of unknown function ...
http://www.cell.com/AJHG/abstract/S0002-9297(09)00462-5...

TUBA8 - SNP Result
... sapiens]GTGAAACCCTGTCTGTACTAAAAGAA[C/T]ACAAAAAATTAGCCGGGTGTGGTGG 8: rs73376851 [Homo sapiens]ACTTGTCTGAGCTCTACAAGCCCAGA[C/T]
TGAAAATAGAACTGAGAGAGACAGG 9: ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp&cmd=search&s...

ARS | Publication request: Radiation Hybrid Mapping of 18 ...
5 May 2006 ... Genetic differences in one of these genes (TUBA8) were strongly associated ... Furthermore, three SNPs in the partial gene sequence of TUBA8 ...
http://www.ars.usda.gov/research/publications/Publications.h...

TUBA8: A new tissue-specific isoform of alpha-tubulin that is ...
We have cloned and sequenced a cDNA from a human adult skeletal muscle cDNA library, encoding for a novel isoform of alpha-tubulin (tuba8) that is ...
http://www.ncbi.nlm.nih.gov/pubmed/10772959...

Additional Table 3
14, NM_017379, Tuba8, Tuba8, 4, AREDLAALEKDYEEVGTDSFEEENEGEEF, NM_018943, TUBA8, TUBA8, 4, AREDLAALEKDYEEVGTDSFEEENEGEEF. 15, NM_001033879, Tubal3, Tubal3 ...
http://www.biomedcentral.com/content/supplementary/1471-2164...

Tubulin, alpha 8 (TUBA8)
Human protein-coding gene TUBA8. Represented by 73 ESTs from 38 cDNA libraries. EST representation biased toward infant. Corresponds to reference sequence ...
http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=137...

A revised nomenclature for the human and rodent α-tubulin gene family
NP_001007005; TUBA8, NP_001019510. The tree is rooted with C. elegans α-2 tubulin (TBA2), .... unnecessary confusion the current nomenclature of TUBA8/
...
http://www.genetics.wustl.edu/sdlab/PDFs/Khodiyar2007.pdf...

Radiation hybrid mapping of 18 positional and physiological ...
CPNE8, PRICKLE1, Q6ZUQ4 and TUBA8 were mapped to the interval for pig AMC ... Three SNPs in TUBA8 co-segregated with the AMC phenotype in 230 pigs of our ...
http://www.ncbi.nlm.nih.gov/pubmed/16734683...

Google Custom Search

Search
  


 

Nothing in this website should be used in place of personal medical advice from your own qualified medical practitioner.

All rights reserved. All other trademarks recognized.
Copyright 1997-2009 - BioPortfolio Limited.