|
| |
Image Results
Loading...
Loading...
tube1 Pages on BioPortfolio:
BioPortfolio - TUBE1 - tubulin, epsilon 1
TUBE1 - tubulin, epsilon 1 - Bioportfolio. ... Search Bioportfolio and other Life Science Sites for TUBE1 This page has been viewed 5229 times ...
http://www.bioportfolio.com/gene/51175-TUBE1.html...
|
Antibody By Gene - T
... beta polypeptide pseudogene 2 · TUBBP3 tubulin, beta polypeptide pseudogene 3 · TUBBP5 tubulin, beta polypeptide pseudogene 5 · TUBE1 tubulin, epsilon 1 ...
http://www.bioportfolio.co.uk/antibody/genes-T.htm...
|
BioPortfolio - Most Popular Pages on Bioportfolio's Gene Database
Gene, Description, Views. TUB8, TUB8 (tubulin beta-8), 10227. TUBE1, tubulin, epsilon 1, 5212. CAM4, CAM4 (CALMODULIN 4); calcium ion binding, 4887 ...
http://www.bioportfolio.com/gene/mostpopular.php...
|
Results from other life science and pharmaceutical sites:
TUBE1 - SNP Result
1: rs16291545 [Gallus gallus]TTCTGCTGATAAATCATTTTGTCTGC[-/TT] TTTTTTTTTGTTGTTGTTGCTGCTG 2: rs16291544 [Gallus ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp&cmd=search&s...
|
BioPortfolio - TUBE1
TUBE1 - tubulin, epsilon 1 - Bioportfolio. ... Search Bioportfolio and other Life Science Sites for TUBE1 This page has been viewed 5138 times . ...
http://www.bioportfolio.com/search/TUBE1.html...
|
AceView: gene:TUBE1, a comprehensive annotation of human, mouse ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs ...
http://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/av.cgi?db=h...
|
Beckman Coulter - Cap Assembly, Tube, 1 in, 25 mm, Aluminum
Product detail for Cap Assembly, Tube, 1 in, 25 mm, Aluminum cap, assembly.
http://www.beckmancoulter.com/eCatalog/CatalogItemDetails.do...
|
Tubulin, epsilon 1 (TUBE1)
Human protein-coding gene TUBE1. Represented by 228 ESTs from 116 cDNA libraries . Corresponds to reference sequence NM_016262.4. [UniGene 136302 - Hs.34851]
http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=348...
|
Waters: Assy, Tube 1/4 Solvent Inlet
Assy, Tube 1/4 Solvent Inlet [700001485]. Quantity: Add to Cart. Overview, Specifications. Assy, Tube 1/4 Solvent Inlet. This spare part is a genuine Waters ...
https://www.waters.com/waters/partDetail.htm?locale=en_US&pa...
|
51175 - Gene Result
1: TUBE1 Official Symbol TUBE1 and Name: tubulin, epsilon 1 [Homo sapiens] Other Aliases: RP1-142L7.1, FLJ22589, FLJ44203, TUBE, dJ142L7.2 Other ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&term=51175...
|
Waters: PEEK Tube, 1/16 x .007in., 5m
PEEK Tube, 1/16 x .007in., 5m [6436010-S5]. Quantity: Add to Cart. Overview, Specifications. This part number replaces part number 700003235. PM Kit, No ...
https://www.waters.com/waters/partDetail.htm?locale=en_US&pa...
|
71924 - Gene Result
1: Tube1 Official Symbol Tube1 and Name: epsilon-tubulin 1 [Mus musculus] Other Aliases: 2310061K05Rik, AI551343, Tube Chromosome: 10; Location: 10 B1 ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&term=71924...
|
Waters: PEEK Tube, 1/16 x .007in., 1m
PEEK Tube, 1/16 x .007in., 1m [6436010-S1]. Quantity: ... PEEK Tube, 1/16 x . 007in., 1m. This spare part is a genuine Waters Quality Part ...
https://www.waters.com/waters/partDetail.htm?locale=en_US&pa...
|
|