|
| |
Image Results
Loading...
Loading...
www.tuba8.com Pages on BioPortfolio:
BioPortfolio - TUBA8 - tubulin, alpha 8
TUBA8 - tubulin, alpha 8 - Bioportfolio. ... TUBA8: A new tissue-specific isoform of alpha-tubulin that is highly conserved in human and mouse. ...
http://www.bioportfolio.com/gene/51807-TUBA8.html...
|
Antibody By Gene - T
... TUBA4 tubulin, alpha 4 · TUBA8 tubulin, alpha 8 · TUBAL1 tubulin, alpha-like 1 · TUBAP tubulin, alpha pseudogene · TUBAP2 tubulin, alpha pseudogene 2 ...
http://www.bioportfolio.co.uk/antibody/genes-T.htm...
|
BioPortfolio - Most Popular Pages on Bioportfolio's Gene Database
BRCA2, breast cancer 2, early onset, 3490. RSF1, remodeling and spacing factor 1 , 2871. MSMB, microseminoprotein, beta-, 2761. TUBA8, tubulin, alpha 8, 2175 ...
http://www.bioportfolio.com/gene/mostpopular.php...
|
Results from other life science and pharmaceutical sites:
BioPortfolio - tuba8.com
TUBA8: A new tissue-specific isoform of alpha-tubulin that is highly conserved in human and ... Search Bioportfolio and other Life Science Sites for TUBA8 . ...
http://www.bioportfolio.com/search/tuba8.com.html...
|
TUBA8: A new tissue-specific isoform of alpha-tubulin that is ...
We have cloned and sequenced a cDNA from a human adult skeletal muscle cDNA library, encoding for a novel isoform of alpha-tubulin (tuba8) that is ...
http://www.ncbi.nlm.nih.gov/pubmed/10772959...
|
BioPortfolio - TUBA8 - tubulin, alpha 8
TUBA8 - tubulin, alpha 8 - Bioportfolio. ... TUBA8: A new tissue-specific isoform of alpha-tubulin that is highly conserved in human and mouse. ...
http://www.bioportfolio.com/gene/51807-TUBA8.html...
|
Tubulin, alpha 8 (TUBA8)
Human protein-coding gene TUBA8. Represented by 73 ESTs from 38 cDNA libraries. EST representation biased toward infant. Corresponds to reference sequence ...
http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=137...
|
ARS | Publication request: Radiation Hybrid Mapping of 18 ...
Five genes mapped to the interval believed to contain the causative gene for AMC (CPNE8, PRICKLE1, Q6ZUQ4, TUBA8 and USP18). Genetic differences in one of ...
http://www.ars.usda.gov/research/publications/publications.h...
|
51807 - Gene Result
1: TUBA8 Official Symbol TUBA8 and Name: tubulin, alpha 8 [Homo sapiens] Other Aliases: TUBAL2 Other Designations: OTTHUMP00000196216; tubulin, alpha-like 2 ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&term=51807...
|
ARS | Publication request: RADIATION HYBRID MAPPING OF 18 ...
Genetic differences in one of these genes (TUBA8) were strongly associated with the ... Furthermore, three SNPs in the partial gene sequence of TUBA8 ...
https://ars.usda.gov/research/publications/publications.htm?...
|
Tubulin, alpha 8 (TUBA8)
Chicken protein-coding gene TUBA8. Represented by 40 ESTs from 5 cDNA libraries. EST representation biased toward testis. Corresponds to reference sequence ...
http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Gga&CID=81...
|
Down with FBS
32, WID:1729211 || H300018484 || TUBA8 -- tubulin, alpha 8 (TUBA8), mRNA. ||, Hs .137400, -1.1438, -0.0505, -0.3912. 33, WID:1729294 || H300012955 || NPIP ...
http://www.nature.com/bjc/journal/v98/n4/extref/6604242x5.xl...
|
TUBA8 - SNP Result
1: rs15290816 [Gallus gallus]AACAACCAGATGGTGAAATGTGACCC[A/G] CGGCATGGGAAGTACATGGCTTGCT 2: rs15290815 [Gallus ...
http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp&cmd=search&s...
|
|