Advertisement

Topics

Protein Hydration Waters are Susceptible to Unfavorable Perturbations.

07:00 EST 7th January 2019 | BioPortfolio

Summary of "Protein Hydration Waters are Susceptible to Unfavorable Perturbations."

The interactions of a protein, its phase behavior, and ultimately, its ability to function, are all influenced by the interactions between the protein and its hydration waters. Here we study proteins with a variety of sizes, shapes, chemistries, and biological functions, and characterize their interactions with their hydration waters using molecular simulations and enhanced sampling techniques. We find that akin to extended hydrophobic surfaces, proteins situate their hydration waters at the edge of a dewetting transition, making them susceptible to unfavorable perturbations. We also find that the strength of the unfavorable potential needed to trigger dewetting is roughly the same for all the proteins studied here, and depends primarily on the width of the hydration shell being perturbed. Our findings establish a framework for systematically classifying protein patches according to how favorably they interact with water.

Affiliation

Journal Details

This article was published in the following journal.

Name: Journal of the American Chemical Society
ISSN: 1520-5126
Pages:

Links

DeepDyve research library

PubMed Articles [11805 Associated PubMed Articles listed on BioPortfolio]

Binding of L-Argininamide to a DNA Aptamer: A Volumetric Study.

We use a combination of volumetric and spectroscopic techniques to characterize the binding of L-argininamide to its aptamer, the 24-base DNA hairpin 5'-d(GATCGAAACGTAGCGCCTTCGATC)-3'. The binding cau...

Toward Comprehensive Measurement of Protein Hydration Dynamics: Facilitation of NMR-based Methods by Reverse Micelle Encapsulation.

Protein-water interactions are a fundamental determinant of protein structure and function. Despite their importance, the molecular details of water orientations and dynamics near protein surfaces rem...

Role of Polar and Nonpolar Groups in the Activity of Antifreeze Proteins: A Molecular Dynamics Simulation Study.

Molecular dynamics simulations have been carried out separately with hyperactive Tenebrio molitor antifreeze protein ( TmAFP) and with its nonactive mutant at 300 K to elucidate the role of polar and ...

Safety of oral hydration after cisplatin infusion in an outpatient lung cancer unit.

Hydration is needed before and after cisplatin infusion for reducing the risk of nephrotoxicity. Even though there is no standard regimen, patients receive mostly intravenous hydration before and afte...

In-cell titration of small solutes controls protein stability and aggregation.

The components of the intracellular environment vary widely in size: from large multi-protein complexes to atomic ions. Besides water, low molecular-weight solutes (< 1 kDa) such as electrolytes, meta...

Clinical Trials [2888 Associated Clinical Trials listed on BioPortfolio]

Mutation Scores and Differential Protein Evaluating Efficacy in Adjuvant Chemotherapy in HER2(-) Luminal B Breast Cancer

We plan to carry out a prospective, randomized, open phase III clinical trial which sponsored by the Tianjin Medical University Cancer Hospital and Institute. The primary aim is to evaluat...

Subcutaneous vs Intravenous Hydration on Older Adults

This study will evaluate the risk of adverse effects of intravenous hydration compared to subcutaneous hydration. Half of the patients will receive hydration by the subcutaneous route the ...

Early Versus Late Hydration After Cesarean Section (CS)

This study evaluates the effect of early oral hydration on bowel movement after CS, it includes 2 groups: study group participants receive 100 ml water after 1hr from the end of CS, while ...

Hydration Status Evaluation of Dehydrated Children With Experimental Devices

A pediatric study in collaboration with Boston Children's Hospital to review the performance of two novel hydration status measurement devices against standard clinical assessment methods,...

Tailored Hydration for the Prevention of Post-ERCP Pancreatitis

Aggressive hydration of lactated Ringer's solution has shown considerable beneficial effect in preventing post-ERCP(endoscopic retrograde cholangiopancreatography) pancreatitis. But the oc...

Medical and Biotech [MESH] Definitions

Therapy by various hot or warm baths in natural mineral waters, spas, or "cures". It includes not only bathing in, but also drinking the waters, but it does not include whirlpool baths (HYDROTHERAPY).

One of the PENICILLINS which is resistant to PENICILLINASE but susceptible to a penicillin-binding protein. It is inactivated by gastric acid so administered by injection.

Area in an environment in which a population of organisms can survive through a period of unfavorable conditions.

Comprehensive, methodical analysis of complex biological systems by monitoring responses to perturbations of biological processes. Large scale, computerized collection and analysis of the data are used to develop and test models of biological systems.

A PEROXISOME-specific enzyme that catalyzes the hydration step of the beta-oxidation pathway.

Advertisement
Quick Search
Advertisement
Advertisement

 


DeepDyve research library

Relevant Topics

Nutrition
Within medicine, nutrition (the study of food and the effect of its components on the body) has many different roles. Appropriate nutrition can help prevent certain diseases, or treat others. In critically ill patients, artificial feeding by tubes need t...

Biological Therapy
Biological therapy involves the use of living organisms, substances derived from living organisms, or laboratory-produced versions of such substances to treat disease. Some biological therapies for cancer use vaccines or bacteria to stimulate the body&rs...


Searches Linking to this Article